Background: Type 2 diabetes (T2D) is a chronic metabolic disease characterised by hyperglycaemia due to insulin resistance and impaired insulin secretion. Genetic and environmental factors can influence predisposition to this disease. Genetic predisposition plays a significant role in the risk of developing the disease, and the TCF7L2 (T-Cell Factor-Like 2) gene is one of the main genes associated with type 2 diabetes. Objective: The aim of this study was to investigate the prevalence of the rs12255372 (G/T) polymorphism in TCF7L2, a gene associated with the risk of type 2 diabete (T2D) in the Ivorian population in the north of Côte d'Ivoire. Methodology: We included a total of 75 participants, 50 with type 2 diabete and 25 healthy subjects, for various anthropometric, clinical and genetic parameters. Participants were recruited from the Korhogo Regional Hospital. After obtaining consent, a blood sample was taken from each participant for glycaemia measurement and confetti realization for molecular biology. Genomic DNA extracted from the confetti was used to perform TCF7L2 gene genotyping using allele-specific PCR. Results: Analysis of the prevalence of the T allele of the SNP rs12255372 showed a statistically significant association between type 2 diabetic patients and non-diabetics (p≤0.05). The analysis revealed a genotypic prevalence of the rs12255372 variant of the TT allele significantly more expressed in non-diabetics (52%) compared with diabetics (26%) (p=0.03, z=2.23). Conclusion: This study revealed a high prevalence of the rs12255372 genetic variant of the TCF7L2 gene in non-diabetic populations in the north of Côte d'Ivoire, suggesting a significant predisposition to types 2 diabetes and the involvement of other factors, such as environmental conditions, lifestyle habits and genetic interactions in the development of type 2 diabetes in healthy subjects carrying the TT allele of the SNP rs12255372 of the TCF7L2 gene.
| Published in | International Journal of Genetics and Genomics (Volume 13, Issue 1) |
| DOI | 10.11648/j.ijgg.20251301.12 |
| Page(s) | 10-19 |
| Creative Commons |
This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited. |
| Copyright |
Copyright © The Author(s), 2025. Published by Science Publishing Group |
Type 2 Diabetes, TCF7L2 Gene Polymorphism, Genetic Predisposition
Polymorphism | primers Nucleotide sequences |
|---|---|
CFw: 5’CTGGAAACTAAGGCGTGAGGGA 3’ | |
rs12255372 G/T | Rev_G: 5’CAGAGGCCTGAGTAATTATCAGAATATGATC 3’ |
Rev_T: 5’CAGAGGCCTGAGTAATTATCAGAATATGCTA 3’ |
Mix for T polymorphism detection | Mix for G polymorphism detection | ||
|---|---|---|---|
Reagents | Volume (µL) | Reagents | Volume (µL) |
H2O Bio- mol | 15 | H2O Bio- mol | 15 |
5X Firepol Master Mix | 4 | 5X Firepol Master Mix | 4 |
CFW | 0.5 | CFW | 0.5 |
Rev T | 0.5 | Rev G | 0.5 |
Volume Mix (µL) | 20 | Volume Mix (µL) | 20 |
DNA | 5 | DNA | 5 |
Reaction volume (µL) | 25 | Reaction volume (µL) | 25 |
Steps | Temperatures (°C) | Time | Cycles |
|---|---|---|---|
Initial denaturation | 95 | 3 min | 1X |
Final denaturation | 95 | 20 sec | 40X |
Hybridization | 60 | 30 Sec | |
Elongation | 72 | 30 Sec | |
Final elongation | 72 | 5 min | 1X |
Clinical parameters and lifestyle habits | By-laws | Total population (n = 150) | Diabetics (n = 100) | Non- Diabetics (n = 150) | p-value |
|---|---|---|---|---|---|
Hypertension | Yes | 56 (37.33%) | 54 (54%) a | 2 (4%) b | 0.0000104 |
No | 94 (62.66%) | 46 (46%) | 48 (96%) | ||
Blood glucose | Hypoglycaemia (< 0.70) | 4 (2.67%) b | 0 (0.0%) b | 4 (8.0%) b | 0.768 |
Normal (0.70 - 1.26) | 88 (58.67%) | 42 (42.0%) | 46 (92.0%) | 0.000034 | |
Hyperglycaemia (> 1.26) | 58 (38.67%) | 58 (58.0%) | 0 (0.0%) | 0.000000116 | |
Weight (Kg) | Mean ± sd | 67.07 ± 14.84 | 66.3 ± 13,81 | 68.6 ± 16.92 | 0.559 |
Min - Max | 38 - 118 | 38 - 101 | 51 - 118 | ||
Smoker | Yes | 2 (1.33%) | 2 (2%) | 0 (0%) | 1.0 |
No | 148 (98.67%) | 98 (98%) | 50 (100%) | ||
Practising sport | Yes | 52 (34.67%) | 34 (34%) | 18 (36%) | 1.0 |
No | 98 (65.33%) | 66 (66%) | 32 (64%) | ||
Alcohol consumption | Yes | 14 (9.33%) | 0 (0.0%) | 14 (28.00%) | 0.00024 |
No | 136 (90.67%) | 100 (100%) | 36 (72¨%) |
DNA | DeoxyriboNucleic Acid |
EDTA | Ethylene Diamine Tetra-Acetic Acid |
PCR | Polymerase Chain Reaction |
PREVADIA-CI | Prevalence of Diabetes in Côte d'Ivoire |
SNP | Single Nucleotide Polymorphism |
TCF7L2 | T-Cell Factor-Like 2 |
T2D | Type 2 Diabete |
| [1] | El Hourch S. Study of genetic predisposition to type 2 diabetes (TCF7L2 gene) and pharmacogenetics of Metformin (SLC47A1 gene) in a Moroccan population. These N°: 27/21, 16/05/2022, Université Mohamed V, 2022, p28 |
| [2] | World Health Organization (WHO). World diabetes report. Executive summary Geneva: WHO, 2016. 4p. Accessed 05/17/2025. Online |
| [3] | Beran D. Diabetes, a major public health problem in Africa. ReMed n° 33, 2006, 25p. Accessed on 17/01/2025; Online: |
| [4] |
International Diabetes Federation (IDF). Diabetes atlas. 8th ed. IDF; 2017. 2p. Accessed 17/01/2025. Online
https://www.federationdesdiabetiques.org/public/content/1/doc/idf-atlas-8e-fr.pdf |
| [5] | Sassor, O. P. A. T., Franck, K. E., Yao, E. K., Ekissi, O. T., Denise, O. K., Stéphane, P. S., Félix, A., Ncho, S. D. Dietary habits among type 2 diabetic patients attending the Abidjan Diabetes Centre, Santé publique, 2017, 29(3) mai-juin 2017: 423-430. Available at: |
| [6] | Noel, D. D., Olefongo, D., Lazare, T., Wagniman, S., Koffi, N. G. B. S., Joel, K. K., Florent, K. A., Eboulé, A. E. R., Guehi, Z. E., & Yangni-Angaté, K. H. (2022). Assessment of recurrently diagnosed diseases dynamism at Korhogo General Hospital in Northern Côte d’Ivoire from 2014 to 2018. International Journal of Medicine and Medical Sciences, 2022, 14(1), 1-19. |
| [7] | Grant, S. F., Thorleifsson, G., Reynisdottir, I., Benedikt, S. R., Manolescu, A., Sainz, J., et Stefansson, K. Variant of transcription factor 7-like 2 (TCF7L2) gène confers Risk of type 2 diabètes. Nature genetics, 2006 Mar; 38(3): 320-3. |
| [8] | Sladek, R., Ghislain, R., Johan, R., Christian, D., Lishuang, S., David, S., Philippe, B., Daniel, V., Alexandre, B., Samy, H., Beverley, B., Barbara, H., Guillaume, C., Thomas J. H., Alexandre, M., Alexey V. Pshezhetsky, M. P, Barry, I. Posner2, David, J. Balding, D. M, Constantin, P., et Philippe, F. A. Genome-wide association study identifies novel risk loci for type 2 diabetes. Nature, 2007, Vol 445| 22 February 2007| |
| [9] | Lyssenko V, Lupi R, Marchetti P, Del Guerra S, Orho-Melander M, Almgren P, Sjögren M, Ling C, Eriksson KF, Lethagen AL, Mancarella R, Berglund G, Tuomi T, Nilsson P, Del Prato S, Groop L. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. Journal of Clinical Investigation. 2007 Aug; 117(8): 2155-63. |
| [10] | Wang J, Zhang J, Li L, Wang Y, Wang Q, Zhai Y, You H, Hu D. Association of rs12255372 in the TCF7L2 gene with type 2 diabetes mellitus: a meta-analysis. Brazilian Journal of Medical and Biological Research. 2013 Apr; 46(4): 382-93. doi: |
| [11] | Cuilin Zhang 1, Lu Qi, David J Hunter, James B Meigs, JoAnn E Manson, Rob M van Dam, Frank B Hu. Variant of transcription factor 7-like 2 (TCF7L2) gene and the risk of type 2 diabetes in large cohorts of U.S. women and men. Diabetes, 2006 Sep; 55(9): 2645-8. |
| [12] | Reyes-López, Ruth; Pérez-Luque, Elva; Malacara, Juan Manuel. Metabolic, hormonal characteristics and genetic variants of TCF7L2 associated with development of gestational diabetes mellitus in Mexican women. Diabetes/Metabolism Research and Reviews, 2014. 30(8), 701–706. |
| [13] | Elhourch S, Arrouchi H, Mekkaoui N, Allou Y, Ghrifi F, Allam L, Elhafidi N, Belyamani L, Ibrahimi A, Elomri N, Eljaoudi R. Significant Association of Polymorphisms in the TCF7L2 Gene with a Higher Risk of Type 2 Diabetes in a Moroccan Population. Journal of Personalized Medicine. 2021 May 24; 11(6): 461. |
| [14] |
Sturges, Herbert A. “The Choice of a Class Interval.” Journal of the American Statistical Association, 1926, vol. 21, no. 153, pp. 65–66. JSTOR,
http://www.jstor.org/stable/2965501 Accessed 17 Jan. 2025. |
| [15] | Assmann TS, Duarte GC, Rheinheimer J, Cruz LA, Canani LH, Crispim D. The TCF7L2 rs7903146 (C/T) polymorphism is associated with risk to type 2 diabetes mellitus in Southern-Brazil. Arquivos Brasileiros de Endocrinologia e Metabologia. 2014 Dec; 58(9): 918-25. |
| [16] | H3Africa Consortium; Rotimi C, Abayomi A, Abimiku A, Adabayeri VM, Adebamowo C, Adebiyi E, Ademola AD, Adeyemo A, Adu D, Affolabi D, Agongo G, Ajayi S, Akarolo-Anthony S, Akinyemi R, Akpalu A, Alberts M, Alonso Betancourt O, Alzohairy AM, Ameni G, Amodu O, Anabwani G, Andersen K, Arogundade F, Arulogun O, Asogun D, Bakare R, Balde N, Baniecki ML, Beiswanger C, Benkahla A, Bethke L, Boehnke M, Boima V, Brandful J, Brooks AI, Brosius FC, Brown C, Bucheton B, Burke DT, Burnett BG, Carrington-Lawrence S, Carstens N, Chisi J, Christoffels A, Cooper R, Cordell H, Crowther N, Croxton T, de Vries J, Derr L, Donkor P, Doumbia S, Duncanson A, Ekem I, El Sayed A, Engel ME, Enyaru JC, Everett D, Fadlelmola FM, Fakunle E, Fischbeck KH, Fischer A, Folarin O, Gamieldien J, Garry RF, Gaseitsiwe S, Gbadegesin R, Ghansah A, Giovanni M, Goesbeck P, Gomez-Olive FX, Grant DS, Grewal R, Guyer M, Hanchard NA, Happi CT, Hazelhurst S, Hennig BJ, Hertz- C, Fowler, Hide W, Hilderbrandt F, Hugo-Hamman C, Ibrahim ME, James R, Jaufeerally-Fakim Y, Jenkins C, Jentsch U, Jiang PP, Joloba M, Jongeneel V, Joubert F, Kader M, Kahn K, Kaleebu P, Kapiga SH, Kassim SK, Kasvosve I, Kayondo J, Keavney B, Kekitiinwa A, Khan SH, Kimmel P, King MC, Kleta R, Koffi M, Kopp J, Kretzler M, Kumuthini J, Kyobe S, Kyobutungi C, Lackland DT, Lacourciere KA, Landouré G, Lawlor R, Lehner T, Lesosky M, Levitt N, Littler K, Lombard Z, Loring JF, Lyantagaye S, Macleod A, Madden EB, Mahomva CR, Makani J, Mamven M, Marape M, Mardon G, Marshall P, Martin DP, Masiga D, Mason R, Mate-Kole M, Matovu E, Mayige M, Mayosi BM, Mbanya JC, McCurdy SA, McCarthy MI, McIlleron H, Mc'Ligeyo SO, Merle C, Mocumbi AO, Mondo C, Moran JV, Motala A, Moxey-Mims M, Mpoloka WS, Msefula CL, Mthiyane T, Mulder N, Mulugeta Gh, Mumba D, Musuku J, Nagdee M, Nash O, Ndiaye D, Nguyen AQ, Nicol M, Nkomazana O, Norris S, Nsangi B, Nyarko A, Nyirenda M, Obe E, Obiakor R, Oduro A, Ofori-Acquah SF, Ogah O, Ogendo S, Ohene-Frempong K, Ojo A, Olanrewaju T, Oli J, Osafo C, Ouwe Missi Oukem-Boyer O, Ovbiagele B, Owen A, Owolabi MO, Owolabi L, Owusu-Dabo E, Pare G, Parekh R, Patterton HG, Penno MB, Peterson J, Pieper R, Plange-Rhule J, Pollak M, Puzak J, Ramesar RS, Ramsay M, Rasooly R, Reddy S, Sabeti PC, Sagoe K, Salako T, Samassékou O, Sandhu MS, Sankoh O, Sarfo FS, Sarr M, Shaboodien G, Sidibe I, Simo G, Simuunza M, Smeeth L, Sobngwi E, Soodyall H, Sorgho H, Sow Bah O, Srinivasan S, Stein DJ, Susser ES, Swanepoel C, Tangwa G, Tareila A, Tastan Bishop O, Tayo B, Tiffin N, Tinto H, Tobin E, Tollman SM, Traoré M, Treadwell MJ, Troyer J, Tsimako-Johnstone M, Tukei V, Ulasi I, Ulenga N, van Rooyen B, Wachinou AP, Waddy SP, Wade A, Wayengera M, Whitworth J, Wideroff L, Winkler CA, Winnicki S, Wonkam A, Yewondwos M, sen T, Yozwiak N, Zar H. Research capacity. Enabling the genomic revolution in Africa. Science. 2014 Jun 20; 344(6190): 1346-8. |
| [17] | Dago, D. N., Daramcoum, W. A. M-P., Dagnogo, O., Kouadio, K. J., Kimou, A. F. Age in Impacting the Occurrence of Chronic Diseases: Case of Recurrently Diagnosed Diseases at Korhogo Regional Hospital in Northern of Cote d’Ivoire. Computational Biology and Bioinformatics, 2022, 10(2): 68-79. |
| [18] | Yao Eugène KONAN, Ekissi Orsot TETCHI, Franck Kokora EKOU, Loukou Gilbert KONAN, Odile TANO-AKE. Profile of diabetics aged 20 to 79 years from the national survey on the prevalence and characteristics of diabetes in Côte d’Ivoire. African Journal of Social Sciences and Public Health, Volume 5 (1) ISSN: 1987-071X e-ISSN 1987-1023. |
| [19] | National Program for the Fight against Metabolic Diseases and Prevention of Non-Communicable Diseases, PNLMM /PMNT (2017). Prevalence and characteristics of diabetes in Côte d’Ivoire – PREVADIA-CI 2017. 55p. |
| [20] |
Saoud, A., 2012 Evaluation of the management of type 2 diabetes at the level of the basic health care network of the city of FES in Morocco. Thesis No. 169/12 from Sidi Mohammed Ben Abdellah University, Faculty of Medicine and Pharmacy; 2012, pp. 57.
https://toubkal.imist.ma/xmlui77/bitstream/handle/123456789/22658/169-12.pdf?sequence=1 |
| [21] | Demirsoy, I., Aras N, et Cinkır, U. TCF7L2 rs7903146 Gene Variation Is Associated with Risk of Type 2 Diabetes in Turkish Population. Journal of Clinical & Medical Genomics, 2016, 4: 1-5. https://doi.org/ |
| [22] | Saraswati M, Suastika K, Safarina G, Ketut Suastika.et Herawati Sudoyo: TCF7L2 gene polymorphisms rs12255372, rs7903146, rs10885406 and association with type 2 diabetes in a population from Legian village, Kuta, Bali. Indonesia Journal of Biomedical Science, 2017, 11 (2): 6-10. |
| [23] | Mandour, I., Darwish R, Salam R, Merva, N. et Sarah, E-S., Polymorphismes du gène like2 du facteur de transcription 7 et susceptibilité au diabète sucré de type 2 dans une cohorte de patients diabétiques égyptiens, une étude pilote. Endocrine Abstracts, 2018, 56: 338-42. |
| [24] | Elhourch S, Arrouchi H, Mekkaoui N, Allou Y, Ghrifi F, Allam L, Elhafidi N, Belyamani L, Ibrahimi A, Elomri N, Eljaoudi R. Significant Association of Polymorphisms in the TCF7L2 Gene with a Higher Risk of Type 2 Diabetes in a Moroccan Population. J Pers Med. 2021 May 24; 11(6): 461. |
| [25] | Bodhini D, Radha V, Dhar M, Narayani N, Mohan V. The rs12255372(G/T) and rs7903146(C/T) polymorphisms of the TCF7L2 gene are associated with type 2 diabetes mellitus in Asian Indians. Metabolism, 2007 Sep; 56(9): 1174-8. |
| [26] | Zhou Y, Park SY, Su J et al. (2014). TCF7L2 is a master regulator of insulin production and processing. Human Molecular Genetics, 2014, 23(24): 6419-31. |
| [27] | Laura del Bosque-Plata, Eduardo Martínez-Martínez, Miguel Ángel, Espinoza-Camacho, Claudia Gragnoli. The Role of TCF7L2 in Type 2 Diabete. Diabetes, 2021; 70(6): 1220–1228. |
| [28] | Florez JC, Jablonski KA, Bayley N, Pollin TI, de Bakker PI, Shuldiner AR, et al. TCF7L2 polymorphisms and progression to diabetes in the Diabetes Prevention Program. New England Journal of Medicine, 2006; 355: 241-50. |
| [29] | Yeasmeen Ali, Sidratul Muntaha, Mahfuza Akter, Khondakar Mohammad Ataul Gani, Sumon Rahman Chowdhury, Farjana Sharmen. Investigation of the association between the TCF7L2 rs12255372 (G/T) gene polymorphism and Gestational Diabetes Mellitus (GDM) in the population of Chattogram, Bangladesh. Endocrine and Metabolic Science. 2023, Volume 13, 1 December 2023, 100149. |
APA Style
Oléfongo, D., Noel, D. D., Korotoum, Y. T., Angélo, K. K. B., David, C. N., et al. (2025). Polymorphism of the rs12255372 Allele of the TCF7L2 Gene Associated with Predisposition to Type 2 Diabete Using SNP Markers in a Population in the North of the Côte d’Ivoire. International Journal of Genetics and Genomics, 13(1), 10-19. https://doi.org/10.11648/j.ijgg.20251301.12
ACS Style
Oléfongo, D.; Noel, D. D.; Korotoum, Y. T.; Angélo, K. K. B.; David, C. N., et al. Polymorphism of the rs12255372 Allele of the TCF7L2 Gene Associated with Predisposition to Type 2 Diabete Using SNP Markers in a Population in the North of the Côte d’Ivoire. Int. J. Genet. Genomics 2025, 13(1), 10-19. doi: 10.11648/j.ijgg.20251301.12
AMA Style
Oléfongo D, Noel DD, Korotoum YT, Angélo KKB, David CN, et al. Polymorphism of the rs12255372 Allele of the TCF7L2 Gene Associated with Predisposition to Type 2 Diabete Using SNP Markers in a Population in the North of the Côte d’Ivoire. Int J Genet Genomics. 2025;13(1):10-19. doi: 10.11648/j.ijgg.20251301.12
@article{10.11648/j.ijgg.20251301.12,
author = {Dagnogo Oléfongo and Dago Dougba Noel and Yeo Tenedjoh Korotoum and Kouman Kouamé Bouatini Angélo and Coulibaly N'golo David and Djaman Allico Joseph},
title = {Polymorphism of the rs12255372 Allele of the TCF7L2 Gene Associated with Predisposition to Type 2 Diabete Using SNP Markers in a Population in the North of the Côte d’Ivoire
},
journal = {International Journal of Genetics and Genomics},
volume = {13},
number = {1},
pages = {10-19},
doi = {10.11648/j.ijgg.20251301.12},
url = {https://doi.org/10.11648/j.ijgg.20251301.12},
eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.ijgg.20251301.12},
abstract = {Background: Type 2 diabetes (T2D) is a chronic metabolic disease characterised by hyperglycaemia due to insulin resistance and impaired insulin secretion. Genetic and environmental factors can influence predisposition to this disease. Genetic predisposition plays a significant role in the risk of developing the disease, and the TCF7L2 (T-Cell Factor-Like 2) gene is one of the main genes associated with type 2 diabetes. Objective: The aim of this study was to investigate the prevalence of the rs12255372 (G/T) polymorphism in TCF7L2, a gene associated with the risk of type 2 diabete (T2D) in the Ivorian population in the north of Côte d'Ivoire. Methodology: We included a total of 75 participants, 50 with type 2 diabete and 25 healthy subjects, for various anthropometric, clinical and genetic parameters. Participants were recruited from the Korhogo Regional Hospital. After obtaining consent, a blood sample was taken from each participant for glycaemia measurement and confetti realization for molecular biology. Genomic DNA extracted from the confetti was used to perform TCF7L2 gene genotyping using allele-specific PCR. Results: Analysis of the prevalence of the T allele of the SNP rs12255372 showed a statistically significant association between type 2 diabetic patients and non-diabetics (p≤0.05). The analysis revealed a genotypic prevalence of the rs12255372 variant of the TT allele significantly more expressed in non-diabetics (52%) compared with diabetics (26%) (p=0.03, z=2.23). Conclusion: This study revealed a high prevalence of the rs12255372 genetic variant of the TCF7L2 gene in non-diabetic populations in the north of Côte d'Ivoire, suggesting a significant predisposition to types 2 diabetes and the involvement of other factors, such as environmental conditions, lifestyle habits and genetic interactions in the development of type 2 diabetes in healthy subjects carrying the TT allele of the SNP rs12255372 of the TCF7L2 gene.
},
year = {2025}
}
TY - JOUR T1 - Polymorphism of the rs12255372 Allele of the TCF7L2 Gene Associated with Predisposition to Type 2 Diabete Using SNP Markers in a Population in the North of the Côte d’Ivoire AU - Dagnogo Oléfongo AU - Dago Dougba Noel AU - Yeo Tenedjoh Korotoum AU - Kouman Kouamé Bouatini Angélo AU - Coulibaly N'golo David AU - Djaman Allico Joseph Y1 - 2025/02/27 PY - 2025 N1 - https://doi.org/10.11648/j.ijgg.20251301.12 DO - 10.11648/j.ijgg.20251301.12 T2 - International Journal of Genetics and Genomics JF - International Journal of Genetics and Genomics JO - International Journal of Genetics and Genomics SP - 10 EP - 19 PB - Science Publishing Group SN - 2376-7359 UR - https://doi.org/10.11648/j.ijgg.20251301.12 AB - Background: Type 2 diabetes (T2D) is a chronic metabolic disease characterised by hyperglycaemia due to insulin resistance and impaired insulin secretion. Genetic and environmental factors can influence predisposition to this disease. Genetic predisposition plays a significant role in the risk of developing the disease, and the TCF7L2 (T-Cell Factor-Like 2) gene is one of the main genes associated with type 2 diabetes. Objective: The aim of this study was to investigate the prevalence of the rs12255372 (G/T) polymorphism in TCF7L2, a gene associated with the risk of type 2 diabete (T2D) in the Ivorian population in the north of Côte d'Ivoire. Methodology: We included a total of 75 participants, 50 with type 2 diabete and 25 healthy subjects, for various anthropometric, clinical and genetic parameters. Participants were recruited from the Korhogo Regional Hospital. After obtaining consent, a blood sample was taken from each participant for glycaemia measurement and confetti realization for molecular biology. Genomic DNA extracted from the confetti was used to perform TCF7L2 gene genotyping using allele-specific PCR. Results: Analysis of the prevalence of the T allele of the SNP rs12255372 showed a statistically significant association between type 2 diabetic patients and non-diabetics (p≤0.05). The analysis revealed a genotypic prevalence of the rs12255372 variant of the TT allele significantly more expressed in non-diabetics (52%) compared with diabetics (26%) (p=0.03, z=2.23). Conclusion: This study revealed a high prevalence of the rs12255372 genetic variant of the TCF7L2 gene in non-diabetic populations in the north of Côte d'Ivoire, suggesting a significant predisposition to types 2 diabetes and the involvement of other factors, such as environmental conditions, lifestyle habits and genetic interactions in the development of type 2 diabetes in healthy subjects carrying the TT allele of the SNP rs12255372 of the TCF7L2 gene. VL - 13 IS - 1 ER -